Osmotically dehydrated and air dried berry fruits are used as elements for the manufacturing of yoghurts, goodies, cereal bars and mixes, ice lotions and desserts and these fruits are sometimes subjected to gentle thermal therapies solely, posing questions round their microbiological security.
As osmotic dehydration strategies and parameters range significantly throughout the trade and minimally processed top quality fruits are more and more sought, the scope of this research was to find out which temperatures are required for the inactivation of related micro organism and viruses throughout osmotic dehydration of berries, utilizing blueberries as a mannequin berry in a thawed state to imitate frequent industrial practices.
Moreover, we studied the inactivation of osmotic dehydration at 23 °C, generally referred to “chilly infusion” adopted by air drying at 100 °C to find out the microbiological security achieved by this mixed remedy. 4 pathogens (Salmonella enterica, Escherichia coli O157:
H7, Listeria monocytogenes and hepatitis A virus (HAV)) and 5 surrogates (Enterococcus faecium, Escherichia coli P1, Listeria innocua, murine Norovirus (MNV) and bacteriophage MS2) had been inoculated on blueberries and reductions had been measured after totally different remedy mixtures. After osmotic dehydration of bacterial strains at 40 °C no survivors had been detected on blueberries, apart from E. faecium.
Inactivation of the viruses at 45 °C confirmed no survivors for MS2 and imply reductions of 1.5 and three.four log10 median tissue tradition infectious dose (TCID50)/g for HAV and MNV, respectively. Equally, within the sugar resolution at 40 °C, no survivors had been noticed, apart from E. faecium and the three viruses. The mixed course of (osmotic dehydration at 23 °C adopted by air-drying at 100 °C) achieved an >6 log discount of all examined bacterial strains and MS2.
EIF3K siRNA |
20-abx915184 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EIF3K antibody |
70R-36346 |
Fitzgerald |
100 ug |
EUR 327.00 |
Description: Rabbit polyclonal EIF3K antibody |
EIF3K Antibody |
34680-100ul |
SAB |
100ul |
EUR 252.00 |
EIF3K Antibody |
34680-50ul |
SAB |
50ul |
EUR 187.00 |
eIF3K antibody |
22622-100ul |
SAB |
100ul |
EUR 390.00 |
EIF3K antibody |
70R-12634 |
Fitzgerald |
100 ul |
EUR 457.00 |
Description: Affinity purified Rabbit polyclonal EIF3K antibody |
EIF3K Antibody |
1-CSB-PA866204ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against EIF3K. Recognizes EIF3K from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000 |
EIF3K Antibody |
DF4052 |
Affbiotech |
200ul |
EUR 304.00 |
Description: EIF3K Antibody detects endogenous levels of total EIF3K. |
EIF3K Antibody |
1-CSB-PA002296 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against EIF3K. Recognizes EIF3K from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000 |
EIF3K Antibody |
CSB-PA693741- |
Cusabio |
|
EUR 335.00 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against EIF3K. Recognizes EIF3K from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
EIF3K Antibody |
CSB-PA693741-100ul |
Cusabio |
100ul |
EUR 316.00 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against EIF3K. Recognizes EIF3K from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
EIF3K Conjugated Antibody |
C34680 |
SAB |
100ul |
EUR 397.00 |
anti- EIF3K antibody |
FNab02712 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: eukaryotic translation initiation factor 3, subunit K
- Uniprot ID: Q9UBQ5
- Gene ID: 27335
- Research Area: Metabolism
|
Description: Antibody raised against EIF3K |
eIF3K Polyclonal Antibody |
ES2245-100ul |
ELK Biotech |
100ul |
EUR 279.00 |
Description: A Rabbit Polyclonal antibody against eIF3K from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
eIF3K Polyclonal Antibody |
ES2245-50ul |
ELK Biotech |
50ul |
EUR 207.00 |
Description: A Rabbit Polyclonal antibody against eIF3K from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
EIF3K Blocking Peptide |
20-abx161607 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
eIF3K Polyclonal Antibody |
ABP51246-003ml |
Abbkine |
0.03ml |
EUR 158.00 |
- Immunogen information: Synthesized peptide derived from the Internal region of human eIF3K at AA range: 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of eIF3K from Human, Mouse. This eIF3K antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human eIF3K at AA range: 30-110 |
eIF3K Polyclonal Antibody |
ABP51246-01ml |
Abbkine |
0.1ml |
EUR 289.00 |
- Immunogen information: Synthesized peptide derived from the Internal region of human eIF3K at AA range: 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of eIF3K from Human, Mouse. This eIF3K antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human eIF3K at AA range: 30-110 |
eIF3K Polyclonal Antibody |
ABP51246-02ml |
Abbkine |
0.2ml |
EUR 414.00 |
- Immunogen information: Synthesized peptide derived from the Internal region of human eIF3K at AA range: 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of eIF3K from Human, Mouse. This eIF3K antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human eIF3K at AA range: 30-110 |
Anti-EIF3K Antibody |
A07789 |
BosterBio |
100ul |
EUR 397.00 |
Description: Rabbit Polyclonal Antibody for EIF3K (EIF3K) detection. Tested with WB in Human. |
Anti-eIF3K Antibody |
A07789-1 |
BosterBio |
100ul |
EUR 397.00 |
Description: Rabbit Polyclonal Antibody for eIF3K Antibody (EIF3K) detection. Tested with WB in Human, Mouse. |
Anti-EIF3K Antibody |
A30681 |
BosterBio |
100ul |
EUR 397.00 |
Description: Rabbit Polyclonal EIF3K Antibody. Validated in WB and tested in Human, Mouse. |
EIF3K Rabbit pAb |
A9969-100ul |
Abclonal |
100 ul |
EUR 308.00 |
EIF3K Rabbit pAb |
A9969-200ul |
Abclonal |
200 ul |
EUR 459.00 |
EIF3K Rabbit pAb |
A9969-20ul |
Abclonal |
20 ul |
EUR 183.00 |
EIF3K Rabbit pAb |
A9969-50ul |
Abclonal |
50 ul |
EUR 223.00 |
EIF3K cloning plasmid |
CSB-CL866204HU-10ug |
Cusabio |
10ug |
EUR 233.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 657
- Sequence: atggcgatgtttgagcagatgagagccaacgtgggcaagttgctcaagggtatcgacaggtacaatcctgagaacctggccaccctggagcgctatgtagagacgcaggccaaggaaaatgcctatgatctggaagccaacctggctgtcctgaagctgtaccagttcaacccagc
- Show more
|
Description: A cloning plasmid for the EIF3K gene. |
EIF3K Blocking Peptide |
DF4052-BP |
Affbiotech |
1mg |
EUR 195.00 |
Anti-eIF3K antibody |
STJ92875 |
St John's Laboratory |
200 µl |
EUR 197.00 |
Description: Rabbit polyclonal to eIF3K. |
Mouse EIF3K shRNA Plasmid |
20-abx978028 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human EIF3K shRNA Plasmid |
20-abx959085 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
EIF3K protein (His tag) |
80R-1730 |
Fitzgerald |
50 ug |
EUR 305.00 |
Description: Purified recombinant Human EIF3K protein |
eIF3k Recombinant Protein (Human) |
RP010423 |
ABM |
100 ug |
Ask for price |
eIF3k Recombinant Protein (Rat) |
RP199370 |
ABM |
100 ug |
Ask for price |
eIF3k Recombinant Protein (Mouse) |
RP131297 |
ABM |
100 ug |
Ask for price |
Polyclonal EIF3K Antibody (C-term) |
AMM05865G |
Leading Biology |
0.1ml |
EUR 484.00 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EIF3K (C-term). This antibody is tested and proven to work in the following applications: |
EIF3K ORF Vector (Human) (pORF) |
ORF003475 |
ABM |
1.0 ug DNA |
EUR 95.00 |
Eif3k ORF Vector (Rat) (pORF) |
ORF066458 |
ABM |
1.0 ug DNA |
EUR 506.00 |
Eif3k ORF Vector (Mouse) (pORF) |
ORF043767 |
ABM |
1.0 ug DNA |
EUR 506.00 |
EIF3K sgRNA CRISPR Lentivector set (Human) |
K0668501 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
Eif3k sgRNA CRISPR Lentivector set (Mouse) |
K4858401 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
Eif3k sgRNA CRISPR Lentivector set (Rat) |
K6347101 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
EIF3K sgRNA CRISPR Lentivector (Human) (Target 1) |
K0668502 |
ABM |
1.0 ug DNA |
EUR 154.00 |
EIF3K sgRNA CRISPR Lentivector (Human) (Target 2) |
K0668503 |
ABM |
1.0 ug DNA |
EUR 154.00 |
EIF3K sgRNA CRISPR Lentivector (Human) (Target 3) |
K0668504 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Eif3k sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4858402 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Eif3k sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4858403 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Eif3k sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4858404 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Eif3k sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6347102 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Eif3k sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6347103 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Eif3k sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6347104 |
ABM |
1.0 ug DNA |
EUR 154.00 |
eIF3k Protein Vector (Mouse) (pPB-C-His) |
PV175066 |
ABM |
500 ng |
EUR 603.00 |
eIF3k Protein Vector (Mouse) (pPB-N-His) |
PV175067 |
ABM |
500 ng |
EUR 603.00 |
eIF3k Protein Vector (Mouse) (pPM-C-HA) |
PV175068 |
ABM |
500 ng |
EUR 603.00 |
eIF3k Protein Vector (Mouse) (pPM-C-His) |
PV175069 |
ABM |
500 ng |
EUR 603.00 |
Recombinant Human EIF3K Protein, His, E.coli-10ug |
QP11769-10ug |
EnQuireBio |
10ug |
EUR 201.00 |
Recombinant Human EIF3K Protein, His, E.coli-1mg |
QP11769-1mg |
EnQuireBio |
1mg |
EUR 5251.00 |
Recombinant Human EIF3K Protein, His, E.coli-2ug |
QP11769-2ug |
EnQuireBio |
2ug |
EUR 155.00 |
eIF3k Protein Vector (Human) (pPB-C-His) |
PV013897 |
ABM |
500 ng |
EUR 329.00 |
eIF3k Protein Vector (Human) (pPB-N-His) |
PV013898 |
ABM |
500 ng |
EUR 329.00 |
eIF3k Protein Vector (Human) (pPM-C-HA) |
PV013899 |
ABM |
500 ng |
EUR 329.00 |
eIF3k Protein Vector (Human) (pPM-C-His) |
PV013900 |
ABM |
500 ng |
EUR 329.00 |
eIF3k Protein Vector (Rat) (pPB-C-His) |
PV265830 |
ABM |
500 ng |
EUR 603.00 |
eIF3k Protein Vector (Rat) (pPB-N-His) |
PV265831 |
ABM |
500 ng |
EUR 603.00 |
eIF3k Protein Vector (Rat) (pPM-C-HA) |
PV265832 |
ABM |
500 ng |
EUR 603.00 |
eIF3k Protein Vector (Rat) (pPM-C-His) |
PV265833 |
ABM |
500 ng |
EUR 603.00 |
Eif3k 3'UTR Luciferase Stable Cell Line |
TU203890 |
ABM |
1.0 ml |
Ask for price |
Eif3k 3'UTR GFP Stable Cell Line |
TU155723 |
ABM |
1.0 ml |
Ask for price |
EIF3K 3'UTR Luciferase Stable Cell Line |
TU006747 |
ABM |
1.0 ml |
EUR 1394.00 |
Eif3k 3'UTR Luciferase Stable Cell Line |
TU105723 |
ABM |
1.0 ml |
Ask for price |
EIF3K 3'UTR GFP Stable Cell Line |
TU056747 |
ABM |
1.0 ml |
EUR 1394.00 |
Eif3k 3'UTR GFP Stable Cell Line |
TU253890 |
ABM |
1.0 ml |
Ask for price |
Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody |
20-abx121897 |
Abbexa |
- EUR 300.00
- EUR 439.00
- EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody |
abx122816-100ug |
Abbexa |
100 ug |
EUR 391.00 |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody |
20-abx135889 |
Abbexa |
- EUR 411.00
- EUR 592.00
- EUR 182.00
- EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody |
20-abx014467 |
Abbexa |
- EUR 314.00
- EUR 98.00
- EUR 398.00
- EUR 495.00
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody |
abx029064-400ul |
Abbexa |
400 ul |
EUR 523.00 |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody |
abx029064-80l |
Abbexa |
80 µl |
EUR 286.00 |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody |
20-abx325584 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody |
20-abx321399 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody |
abx330943-100ul |
Abbexa |
100 ul |
EUR 425.00 |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody |
abx232712-100ug |
Abbexa |
100 ug |
EUR 509.00 |
- Shipped within 5-12 working days.
|
Human Eukaryotic translation initiation factor 3 subunit K (EIF3K) |
1-CSB-EP866204HU |
Cusabio |
- EUR 611.00
- EUR 309.00
- EUR 1827.00
- EUR 939.00
- EUR 1218.00
- EUR 397.00
|
|
- MW: 51.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Eukaryotic translation initiation factor 3 subunit K(EIF3K) expressed in E.coli |
EIF3K Eukaryotic Translation Initiation Factor 3K Human Recombinant Protein |
PROTQ9UBQ5 |
BosterBio |
Regular: 10ug |
EUR 317.00 |
Description: EIF3K produced in E.Coli is a single, non-glycosylated polypeptide chain containing 238 amino acids (1-218a.a.) and having a molecular mass of 27.2 kDa. ;EIF3K is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Recombinant Aspergillus Clavatus EIF3K Protein (aa 1-249) [His] |
VAng-Wyb3769-1mg |
Creative Biolabs |
1 mg |
EUR 4205.00 |
Description: Aspergillus Clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1) Eukaryotic Translation Initiation Factor 3 Subunit K, recombinant protein. |
EIF3K sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
K0668505 |
ABM |
3 x 1.0 ug |
EUR 376.00 |
Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse) |
K4858405 |
ABM |
3 x 1.0 ug |
EUR 376.00 |
Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat) |
K6347105 |
ABM |
3 x 1.0 ug |
EUR 376.00 |
EIF3K sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
K0668506 |
ABM |
1.0 ug DNA |
EUR 167.00 |
EIF3K sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
K0668507 |
ABM |
1.0 ug DNA |
EUR 167.00 |
EIF3K sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
K0668508 |
ABM |
1.0 ug DNA |
EUR 167.00 |
Human Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) ELISA Kit |
abx387100-96tests |
Abbexa |
96 tests |
EUR 911.00 |
- Shipped within 5-12 working days.
|
Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1) |
K4858406 |
ABM |
1.0 ug DNA |
EUR 167.00 |
Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2) |
K4858407 |
ABM |
1.0 ug DNA |
EUR 167.00 |
Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3) |
K4858408 |
ABM |
1.0 ug DNA |
EUR 167.00 |
Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1) |
K6347106 |
ABM |
1.0 ug DNA |
EUR 167.00 |
Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2) |
K6347107 |
ABM |
1.0 ug DNA |
EUR 167.00 |
Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3) |
K6347108 |
ABM |
1.0 ug DNA |
EUR 167.00 |
For HAV and MNV, 2.6 and >3.four log10 TCID50/g had been measured. In abstract, the current research exhibits that osmotic dehydration seems an environment friendly management measure for the management of L. monocytogenes, S. enterica and E. coli O157:H7 if carried out at 40 °C or at 23 °C and adopted by air-drying at 100 °C. Primarily based on the outcomes generated with MNV, the mixed remedy can also be anticipated to scale back human Norovirus (NoV) however doesn’t seem like adequate to totally management HAV.
The outcomes contribute to a greater administration of the microbial security of osmotically dehydrated and dried berries and particularly the outcomes generated for the viruses emphasize that inside a strong meals security administration system, security have to be assured via the complete meals provide chain and due to this fact should begin at main manufacturing with the implementation of Good Agricultural Practices (GAP).