Inactivation by osmotic dehydration and air drying of Salmonella, Shiga toxin-producing Escherichia coli, Listeria monocytogenes, hepatitis A virus and selected surrogates on blueberries.

Osmotically dehydrated and air dried berry fruits are used as elements for the manufacturing of yoghurts, goodies, cereal bars and mixes, ice lotions and desserts and these fruits are sometimes subjected to gentle thermal therapies solely, posing questions round their microbiological security.

As osmotic dehydration strategies and parameters range significantly throughout the trade and minimally processed top quality fruits are more and more sought, the scope of this research was to find out which temperatures are required for the inactivation of related micro organism and viruses throughout osmotic dehydration of berries, utilizing blueberries as a mannequin berry in a thawed state to imitate frequent industrial practices.

Moreover, we studied the inactivation of osmotic dehydration at 23 °C, generally referred to “chilly infusion” adopted by air drying at 100 °C to find out the microbiological security achieved by this mixed remedy. 4 pathogens (Salmonella enterica, Escherichia coli O157:

H7, Listeria monocytogenes and hepatitis A virus (HAV)) and 5 surrogates (Enterococcus faecium, Escherichia coli P1, Listeria innocua, murine Norovirus (MNV) and bacteriophage MS2) had been inoculated on blueberries and reductions had been measured after totally different remedy mixtures. After osmotic dehydration of bacterial strains at 40 °C no survivors had been detected on blueberries, apart from E. faecium.

Inactivation of the viruses at 45 °C confirmed no survivors for MS2 and imply reductions of 1.5 and three.four log10 median tissue tradition infectious dose (TCID50)/g for HAV and MNV, respectively. Equally, within the sugar resolution at 40 °C, no survivors had been noticed, apart from E. faecium and the three viruses. The mixed course of (osmotic dehydration at 23 °C adopted by air-drying at 100 °C) achieved an >6 log discount of all examined bacterial strains and MS2.

EIF3K antibody

70R-12634 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal EIF3K antibody

EIF3K Antibody

34680-100ul 100ul
EUR 252

EIF3K Antibody

34680-50ul 50ul
EUR 187

EIF3K Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF3K. Recognizes EIF3K from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

EIF3K Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against EIF3K. Recognizes EIF3K from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EIF3K Antibody

CSB-PA693741-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against EIF3K. Recognizes EIF3K from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EIF3K Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF3K. Recognizes EIF3K from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

EIF3K Antibody

DF4052 200ul
EUR 304
Description: EIF3K Antibody detects endogenous levels of total EIF3K.

EIF3K antibody

70R-36346 100 ug
EUR 327
Description: Rabbit polyclonal EIF3K antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF3K Antibody

ABD4052 100 ug
EUR 438


PVT18652 2 ug
EUR 231

Anti-EIF3K Antibody

A07789 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for EIF3K (EIF3K) detection. Tested with WB in Human.

Anti-eIF3K Antibody

A07789-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for eIF3K Antibody (EIF3K) detection. Tested with WB in Human, Mouse.

EIF3K Blocking Peptide

DF4052-BP 1mg
EUR 195

EIF3K Blocking Peptide

  • EUR 606.00
  • EUR 1428.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

EIF3K Conjugated Antibody

C34680 100ul
EUR 397

EIF3K cloning plasmid

CSB-CL866204HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 657
  • Sequence: atggcgatgtttgagcagatgagagccaacgtgggcaagttgctcaagggtatcgacaggtacaatcctgagaacctggccaccctggagcgctatgtagagacgcaggccaaggaaaatgcctatgatctggaagccaacctggctgtcctgaagctgtaccagttcaacccagc
  • Show more
Description: A cloning plasmid for the EIF3K gene.

eIF3K Polyclonal Antibody

ABP51246-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human eIF3K at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of eIF3K from Human, Mouse. This eIF3K antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human eIF3K at AA range: 30-110

eIF3K Polyclonal Antibody

ABP51246-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human eIF3K at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of eIF3K from Human, Mouse. This eIF3K antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human eIF3K at AA range: 30-110

eIF3K Polyclonal Antibody

ABP51246-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human eIF3K at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of eIF3K from Human, Mouse. This eIF3K antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human eIF3K at AA range: 30-110

EIF3K Rabbit pAb

A9969-100ul 100 ul
EUR 308

EIF3K Rabbit pAb

A9969-200ul 200 ul
EUR 459

EIF3K Rabbit pAb

A9969-20ul 20 ul
EUR 183

EIF3K Rabbit pAb

A9969-50ul 50 ul
EUR 223

Anti-EIF3K Antibody

A30681 100ul
EUR 397
Description: Rabbit Polyclonal EIF3K Antibody. Validated in WB and tested in Human, Mouse.

eIF3K Polyclonal Antibody

ES2245-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against eIF3K from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

eIF3K Polyclonal Antibody

ES2245-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against eIF3K from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- EIF3K antibody

FNab02712 100µg
EUR 548.75
  • Immunogen: eukaryotic translation initiation factor 3, subunit K
  • Uniprot ID: Q9UBQ5
  • Gene ID: 27335
  • Research Area: Metabolism
Description: Antibody raised against EIF3K

Anti-EIF3K antibody

PAab02712 100 ug
EUR 386

pENTR223-EIF3K vector

PVT11857 2 ug
EUR 304

Anti-EIF3K antibody

STJ112010 100 µl
EUR 277

Anti-eIF3K antibody

STJ92875 200 µl
EUR 197
Description: Rabbit polyclonal to eIF3K.

EIF3K protein (His tag)

80R-1730 50 ug
EUR 305
Description: Purified recombinant Human EIF3K protein

Mouse Eif3k ELISA KIT

ELI-10000m 96 Tests
EUR 865


ELI-08650b 96 Tests
EUR 928


EF009346 96 Tests
EUR 689

Mouse EIF3K shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EIF3K shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-32671h 96 Tests
EUR 824

eIF3k Recombinant Protein (Human)

RP010423 100 ug Ask for price

eIF3k Recombinant Protein (Rat)

RP199370 100 ug Ask for price

eIF3k Recombinant Protein (Mouse)

RP131297 100 ug Ask for price

Polyclonal EIF3K Antibody (C-term)

AMM05865G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EIF3K (C-term). This antibody is tested and proven to work in the following applications:

Eif3k ORF Vector (Rat) (pORF)

ORF066458 1.0 ug DNA
EUR 506

EIF3K ORF Vector (Human) (pORF)

ORF003475 1.0 ug DNA
EUR 95

Eif3k ORF Vector (Mouse) (pORF)

ORF043767 1.0 ug DNA
EUR 506

Eif3k sgRNA CRISPR Lentivector set (Mouse)

K4858401 3 x 1.0 ug
EUR 339

EIF3K sgRNA CRISPR Lentivector set (Human)

K0668501 3 x 1.0 ug
EUR 339

Eif3k sgRNA CRISPR Lentivector set (Rat)

K6347101 3 x 1.0 ug
EUR 339

Eif3k sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4858402 1.0 ug DNA
EUR 154

Eif3k sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4858403 1.0 ug DNA
EUR 154

Eif3k sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4858404 1.0 ug DNA
EUR 154

EIF3K sgRNA CRISPR Lentivector (Human) (Target 1)

K0668502 1.0 ug DNA
EUR 154

EIF3K sgRNA CRISPR Lentivector (Human) (Target 2)

K0668503 1.0 ug DNA
EUR 154

EIF3K sgRNA CRISPR Lentivector (Human) (Target 3)

K0668504 1.0 ug DNA
EUR 154

Eif3k sgRNA CRISPR Lentivector (Rat) (Target 1)

K6347102 1.0 ug DNA
EUR 154

Eif3k sgRNA CRISPR Lentivector (Rat) (Target 2)

K6347103 1.0 ug DNA
EUR 154

Eif3k sgRNA CRISPR Lentivector (Rat) (Target 3)

K6347104 1.0 ug DNA
EUR 154

eIF3k Protein Vector (Mouse) (pPB-C-His)

PV175066 500 ng
EUR 603

eIF3k Protein Vector (Mouse) (pPB-N-His)

PV175067 500 ng
EUR 603

eIF3k Protein Vector (Mouse) (pPM-C-HA)

PV175068 500 ng
EUR 603

eIF3k Protein Vector (Mouse) (pPM-C-His)

PV175069 500 ng
EUR 603

eIF3k Protein Vector (Rat) (pPB-C-His)

PV265830 500 ng
EUR 603

eIF3k Protein Vector (Rat) (pPB-N-His)

PV265831 500 ng
EUR 603

eIF3k Protein Vector (Rat) (pPM-C-HA)

PV265832 500 ng
EUR 603

eIF3k Protein Vector (Rat) (pPM-C-His)

PV265833 500 ng
EUR 603

eIF3k Protein Vector (Human) (pPB-C-His)

PV013897 500 ng
EUR 329

eIF3k Protein Vector (Human) (pPB-N-His)

PV013898 500 ng
EUR 329

eIF3k Protein Vector (Human) (pPM-C-HA)

PV013899 500 ng
EUR 329

eIF3k Protein Vector (Human) (pPM-C-His)

PV013900 500 ng
EUR 329

Recombinant Human EIF3K Protein, His, E.coli-10ug

QP11769-10ug 10ug
EUR 201

Recombinant Human EIF3K Protein, His, E.coli-1mg

QP11769-1mg 1mg
EUR 5251

Recombinant Human EIF3K Protein, His, E.coli-2ug

QP11769-2ug 2ug
EUR 155

Eif3k 3'UTR GFP Stable Cell Line

TU155723 1.0 ml Ask for price

Eif3k 3'UTR Luciferase Stable Cell Line

TU105723 1.0 ml Ask for price

Eif3k 3'UTR Luciferase Stable Cell Line

TU203890 1.0 ml Ask for price

Eif3k 3'UTR GFP Stable Cell Line

TU253890 1.0 ml Ask for price

EIF3K 3'UTR GFP Stable Cell Line

TU056747 1.0 ml
EUR 1394

EIF3K 3'UTR Luciferase Stable Cell Line

TU006747 1.0 ml
EUR 1394

Human Eukaryotic translation initiation factor 3 subunit K (EIF3K)

  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 51.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Eukaryotic translation initiation factor 3 subunit K(EIF3K) expressed in E.coli

Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody

abx122816-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody

abx029064-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody

abx029064-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody

abx330943-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody

abx232712-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

EIF3K Eukaryotic Translation Initiation Factor 3K Human Recombinant Protein

PROTQ9UBQ5 Regular: 10ug
EUR 317
Description: EIF3K produced in E.Coli is a single, non-glycosylated polypeptide chain containing 238 amino acids (1-218a.a.) and having a molecular mass of 27.2 kDa. ;EIF3K is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Recombinant Aspergillus Clavatus EIF3K Protein (aa 1-249) [His]

VAng-Wyb3769-1mg 1 mg
EUR 4205
Description: Aspergillus Clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1) Eukaryotic Translation Initiation Factor 3 Subunit K, recombinant protein.

Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4858405 3 x 1.0 ug
EUR 376

EIF3K sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0668505 3 x 1.0 ug
EUR 376

Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6347105 3 x 1.0 ug
EUR 376

Human Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) ELISA Kit

abx387100-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4858406 1.0 ug DNA
EUR 167

Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4858407 1.0 ug DNA
EUR 167

Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4858408 1.0 ug DNA
EUR 167

EIF3K sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0668506 1.0 ug DNA
EUR 167

EIF3K sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0668507 1.0 ug DNA
EUR 167

EIF3K sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0668508 1.0 ug DNA
EUR 167

Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6347106 1.0 ug DNA
EUR 167

Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6347107 1.0 ug DNA
EUR 167

Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6347108 1.0 ug DNA
EUR 167

For HAV and MNV, 2.6 and >3.four log10 TCID50/g had been measured. In abstract, the current research exhibits that osmotic dehydration seems an environment friendly management measure for the management of L. monocytogenes, S. enterica and E. coli O157:H7 if carried out at 40 °C or at 23 °C and adopted by air-drying at 100 °C. Primarily based on the outcomes generated with MNV, the mixed remedy can also be anticipated to scale back human Norovirus (NoV) however doesn’t seem like adequate to totally management HAV.

The outcomes contribute to a greater administration of the microbial security of osmotically dehydrated and dried berries and particularly the outcomes generated for the viruses emphasize that inside a strong meals security administration system, security have to be assured via the complete meals provide chain and due to this fact should begin at main manufacturing with the implementation of Good Agricultural Practices (GAP).

Scroll to Top