Inactivation by osmotic dehydration and air drying of Salmonella, Shiga toxin-producing Escherichia coli, Listeria monocytogenes, hepatitis A virus and selected surrogates on blueberries.

Osmotically dehydrated and air dried berry fruits are used as elements for the manufacturing of yoghurts, goodies, cereal bars and mixes, ice lotions and desserts and these fruits are sometimes subjected to gentle thermal therapies solely, posing questions round their microbiological security.

As osmotic dehydration strategies and parameters range significantly throughout the trade and minimally processed top quality fruits are more and more sought, the scope of this research was to find out which temperatures are required for the inactivation of related micro organism and viruses throughout osmotic dehydration of berries, utilizing blueberries as a mannequin berry in a thawed state to imitate frequent industrial practices.

Moreover, we studied the inactivation of osmotic dehydration at 23 °C, generally referred to “chilly infusion” adopted by air drying at 100 °C to find out the microbiological security achieved by this mixed remedy. 4 pathogens (Salmonella enterica, Escherichia coli O157:

H7, Listeria monocytogenes and hepatitis A virus (HAV)) and 5 surrogates (Enterococcus faecium, Escherichia coli P1, Listeria innocua, murine Norovirus (MNV) and bacteriophage MS2) had been inoculated on blueberries and reductions had been measured after totally different remedy mixtures. After osmotic dehydration of bacterial strains at 40 °C no survivors had been detected on blueberries, apart from E. faecium.

Inactivation of the viruses at 45 °C confirmed no survivors for MS2 and imply reductions of 1.5 and three.four log₁₀ median tissue tradition infectious dose (TCID₅₀)/g for HAV and MNV, respectively. Equally, within the sugar resolution at 40 °C, no survivors had been noticed, apart from E. faecium and the three viruses. The mixed course of (osmotic dehydration at 23 °C adopted by air-drying at 100 °C) achieved an >6 log discount of all examined bacterial strains and MS2.

EIF3K siRNA
20-abx915184	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

eIF3K antibody
22622-100ul	SAB	100ul	EUR 390.00

EIF3K antibody
70R-36346	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal EIF3K antibody

EIF3K Antibody
ABD4052	Lifescience Market	100 ug	EUR 438.00

EIF3K Antibody
CSB-PA693741-	Cusabio		EUR 335.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against EIF3K. Recognizes EIF3K from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EIF3K Antibody
CSB-PA693741-100ul	Cusabio	100ul	EUR 316.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against EIF3K. Recognizes EIF3K from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EIF3K Antibody
1-CSB-PA866204ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF3K. Recognizes EIF3K from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

EIF3K Antibody
1-CSB-PA002296	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF3K. Recognizes EIF3K from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

EIF3K Antibody
34680-100ul	SAB	100ul	EUR 252.00

EIF3K Antibody
34680-50ul	SAB	50ul	EUR 187.00

EIF3K antibody
70R-12634	Fitzgerald	100 ul	EUR 457.00
Description: Affinity purified Rabbit polyclonal EIF3K antibody

pOTB7-EIF3K
PVT18652	Lifescience Market	2 ug	EUR 231.00

EIF3K Antibody
DF4052	Affbiotech	200ul	EUR 304.00
Description: EIF3K Antibody detects endogenous levels of total EIF3K.

Anti-EIF3K Antibody
A30681	BosterBio	100ul	EUR 397.00
Description: Rabbit Polyclonal EIF3K Antibody. Validated in WB and tested in Human, Mouse.

Anti-EIF3K Antibody
A07789	BosterBio	100ul	EUR 397.00
Description: Rabbit Polyclonal Antibody for EIF3K (EIF3K) detection. Tested with WB in Human.

Anti-eIF3K Antibody
A07789-1	BosterBio	100ul	EUR 397.00
Description: Rabbit Polyclonal Antibody for eIF3K Antibody (EIF3K) detection. Tested with WB in Human, Mouse.

eIF3K Polyclonal Antibody
ABP51246-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from the Internal region of human eIF3K at AA range: 30-110 Applications tips:
Description: A polyclonal antibody for detection of eIF3K from Human, Mouse. This eIF3K antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human eIF3K at AA range: 30-110

eIF3K Polyclonal Antibody
ABP51246-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from the Internal region of human eIF3K at AA range: 30-110 Applications tips:
Description: A polyclonal antibody for detection of eIF3K from Human, Mouse. This eIF3K antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human eIF3K at AA range: 30-110

eIF3K Polyclonal Antibody
ABP51246-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from the Internal region of human eIF3K at AA range: 30-110 Applications tips:
Description: A polyclonal antibody for detection of eIF3K from Human, Mouse. This eIF3K antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human eIF3K at AA range: 30-110

EIF3K Polyclonal Antibody
E-AB-31296-120uL	Elabscience Biotechnology	120uL	EUR 257.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4. Purified by: Affinity purification Background: The 700-kD eukaryotic translation initiation factor-3 (eIF3) is the largest eIF and contains Show more
Description: Rabbit antibody against Human,Mouse EIF3K for WB,ELISA applications.

EIF3K Polyclonal Antibody
E-AB-31296-20uL	Elabscience Biotechnology	20uL	EUR 130.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4. Purified by: Affinity purification Background: The 700-kD eukaryotic translation initiation factor-3 (eIF3) is the largest eIF and contains Show more
Description: Rabbit antibody against Human,Mouse EIF3K for WB,ELISA applications.

EIF3K Polyclonal Antibody
E-AB-31296-60uL	Elabscience Biotechnology	60uL	EUR 175.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4. Purified by: Affinity purification Background: The 700-kD eukaryotic translation initiation factor-3 (eIF3) is the largest eIF and contains Show more
Description: Rabbit antibody against Human,Mouse EIF3K for WB,ELISA applications.

eIF3K Polyclonal Antibody
ES2245-100ul	ELK Biotech	100ul	EUR 279.00
Description: A Rabbit Polyclonal antibody against eIF3K from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

eIF3K Polyclonal Antibody
ES2245-50ul	ELK Biotech	50ul	EUR 207.00
Description: A Rabbit Polyclonal antibody against eIF3K from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EIF3K cloning plasmid
CSB-CL866204HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 657 Sequence: atggcgatgtttgagcagatgagagccaacgtgggcaagttgctcaagggtatcgacaggtacaatcctgagaacctggccaccctggagcgctatgtagagacgcaggccaaggaaaatgcctatgatctggaagccaacctggctgtcctgaagctgtaccagttcaacccagc Show more
Description: A cloning plasmid for the EIF3K gene.

EIF3K Conjugated Antibody
C34680	SAB	100ul	EUR 397.00

EIF3K Blocking Peptide
20-abx161607	Abbexa	EUR 606.00 EUR 1428.00	1 mg 5 mg
Shipped within 5-10 working days.

pENTR223-EIF3K vector
PVT11857	Lifescience Market	2 ug	EUR 304.00

EIF3K Blocking Peptide
DF4052-BP	Affbiotech	1mg	EUR 195.00

Anti-EIF3K antibody
PAab02712	Lifescience Market	100 ug	EUR 386.00

EIF3K Rabbit pAb
A9969-100ul	Abclonal	100 ul	EUR 308.00

EIF3K Rabbit pAb
A9969-200ul	Abclonal	200 ul	EUR 459.00

EIF3K Rabbit pAb
A9969-20ul	Abclonal	20 ul	EUR 183.00

EIF3K Rabbit pAb
A9969-50ul	Abclonal	50 ul	EUR 223.00

anti- EIF3K antibody
FNab02712	FN Test	100µg	EUR 548.75
Immunogen: eukaryotic translation initiation factor 3, subunit K Uniprot ID: Q9UBQ5 Gene ID: 27335 Research Area: Metabolism
Description: Antibody raised against EIF3K

Anti-EIF3K antibody
STJ112010	St John's Laboratory	100 µl	EUR 277.00

Anti-eIF3K antibody
STJ92875	St John's Laboratory	200 µl	EUR 197.00
Description: Rabbit polyclonal to eIF3K.

EIF3K protein (His tag)
80R-1730	Fitzgerald	50 ug	EUR 305.00
Description: Purified recombinant Human EIF3K protein

Human EIF3K ELISA KIT
ELI-32671h	Lifescience Market	96 Tests	EUR 824.00

EIF3K ELISA KIT|Human
EF009346	Lifescience Market	96 Tests	EUR 689.00

Mouse Eif3k ELISA KIT
ELI-10000m	Lifescience Market	96 Tests	EUR 865.00

Bovine EIF3K ELISA KIT
ELI-08650b	Lifescience Market	96 Tests	EUR 928.00

Human EIF3K shRNA Plasmid
20-abx959085	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse EIF3K shRNA Plasmid
20-abx978028	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

eIF3k Recombinant Protein (Human)
RP010423	ABM	100 ug	Ask for price

eIF3k Recombinant Protein (Mouse)
RP131297	ABM	100 ug	Ask for price

eIF3k Recombinant Protein (Rat)
RP199370	ABM	100 ug	Ask for price

EIF3K ORF Vector (Human) (pORF)
ORF003475	ABM	1.0 ug DNA	EUR 95.00

Eif3k ORF Vector (Rat) (pORF)
ORF066458	ABM	1.0 ug DNA	EUR 506.00

Eif3k ORF Vector (Mouse) (pORF)
ORF043767	ABM	1.0 ug DNA	EUR 506.00

Polyclonal EIF3K Antibody (C-term)
AMM05865G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EIF3K (C-term). This antibody is tested and proven to work in the following applications:

EIF3K sgRNA CRISPR Lentivector set (Human)
K0668501	ABM	3 x 1.0 ug	EUR 339.00

Eif3k sgRNA CRISPR Lentivector set (Mouse)
K4858401	ABM	3 x 1.0 ug	EUR 339.00

Eif3k sgRNA CRISPR Lentivector set (Rat)
K6347101	ABM	3 x 1.0 ug	EUR 339.00

EIF3K sgRNA CRISPR Lentivector (Human) (Target 1)
K0668502	ABM	1.0 ug DNA	EUR 154.00

EIF3K sgRNA CRISPR Lentivector (Human) (Target 2)
K0668503	ABM	1.0 ug DNA	EUR 154.00

EIF3K sgRNA CRISPR Lentivector (Human) (Target 3)
K0668504	ABM	1.0 ug DNA	EUR 154.00

eIF3k Protein Vector (Rat) (pPB-C-His)
PV265830	ABM	500 ng	EUR 603.00

eIF3k Protein Vector (Rat) (pPB-N-His)
PV265831	ABM	500 ng	EUR 603.00

eIF3k Protein Vector (Rat) (pPM-C-HA)
PV265832	ABM	500 ng	EUR 603.00

eIF3k Protein Vector (Rat) (pPM-C-His)
PV265833	ABM	500 ng	EUR 603.00

EIF3K 3'UTR Luciferase Stable Cell Line
TU006747	ABM	1.0 ml	EUR 1394.00

EIF3K 3'UTR GFP Stable Cell Line
TU056747	ABM	1.0 ml	EUR 1394.00

Eif3k sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4858402	ABM	1.0 ug DNA	EUR 154.00

Eif3k sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4858403	ABM	1.0 ug DNA	EUR 154.00

Eif3k sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4858404	ABM	1.0 ug DNA	EUR 154.00

Eif3k sgRNA CRISPR Lentivector (Rat) (Target 1)
K6347102	ABM	1.0 ug DNA	EUR 154.00

Eif3k sgRNA CRISPR Lentivector (Rat) (Target 2)
K6347103	ABM	1.0 ug DNA	EUR 154.00

Eif3k sgRNA CRISPR Lentivector (Rat) (Target 3)
K6347104	ABM	1.0 ug DNA	EUR 154.00

eIF3k Protein Vector (Mouse) (pPB-C-His)
PV175066	ABM	500 ng	EUR 603.00

eIF3k Protein Vector (Mouse) (pPB-N-His)
PV175067	ABM	500 ng	EUR 603.00

eIF3k Protein Vector (Mouse) (pPM-C-HA)
PV175068	ABM	500 ng	EUR 603.00

eIF3k Protein Vector (Mouse) (pPM-C-His)
PV175069	ABM	500 ng	EUR 603.00

Eif3k 3'UTR GFP Stable Cell Line
TU155723	ABM	1.0 ml	Ask for price

Eif3k 3'UTR GFP Stable Cell Line
TU253890	ABM	1.0 ml	Ask for price

Eif3k 3'UTR Luciferase Stable Cell Line
TU203890	ABM	1.0 ml	Ask for price

Eif3k 3'UTR Luciferase Stable Cell Line
TU105723	ABM	1.0 ml	Ask for price

eIF3k Protein Vector (Human) (pPB-C-His)
PV013897	ABM	500 ng	EUR 329.00

eIF3k Protein Vector (Human) (pPB-N-His)
PV013898	ABM	500 ng	EUR 329.00

eIF3k Protein Vector (Human) (pPM-C-HA)
PV013899	ABM	500 ng	EUR 329.00

eIF3k Protein Vector (Human) (pPM-C-His)
PV013900	ABM	500 ng	EUR 329.00

Recombinant Human EIF3K Protein, His, E.coli-10ug
QP11769-10ug	EnQuireBio	10ug	EUR 201.00

Recombinant Human EIF3K Protein, His, E.coli-1mg
QP11769-1mg	EnQuireBio	1mg	EUR 5251.00

Recombinant Human EIF3K Protein, His, E.coli-2ug
QP11769-2ug	EnQuireBio	2ug	EUR 155.00

Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody
abx232712-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody
abx029064-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody
abx029064-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody
20-abx014467	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody
20-abx321399	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody
20-abx325584	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Human Eukaryotic translation initiation factor 3 subunit K (EIF3K)
1-CSB-EP866204HU	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 51.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Eukaryotic translation initiation factor 3 subunit K(EIF3K) expressed in E.coli

Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody
abx330943-100ul	Abbexa	100 ul	EUR 425.00
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody
20-abx121897	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody
abx122816-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) Antibody
20-abx135889	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

EIF3K Eukaryotic Translation Initiation Factor 3K Human Recombinant Protein
PROTQ9UBQ5	BosterBio	Regular: 10ug	EUR 317.00
Description: EIF3K produced in E.Coli is a single, non-glycosylated polypeptide chain containing 238 amino acids (1-218a.a.) and having a molecular mass of 27.2 kDa. ;EIF3K is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Recombinant Aspergillus Clavatus EIF3K Protein (aa 1-249) [His]
VAng-Wyb3769-1mg	Creative Biolabs	1 mg	EUR 4205.00
Description: Aspergillus Clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1) Eukaryotic Translation Initiation Factor 3 Subunit K, recombinant protein.

EIF3K sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0668505	ABM	3 x 1.0 ug	EUR 376.00

Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4858405	ABM	3 x 1.0 ug	EUR 376.00

Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6347105	ABM	3 x 1.0 ug	EUR 376.00

Human Eukaryotic Translation Initiation Factor 3 Subunit K (EIF3K) ELISA Kit
abx387100-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

EIF3K sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0668506	ABM	1.0 ug DNA	EUR 167.00

EIF3K sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0668507	ABM	1.0 ug DNA	EUR 167.00

EIF3K sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0668508	ABM	1.0 ug DNA	EUR 167.00

Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4858406	ABM	1.0 ug DNA	EUR 167.00

Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4858407	ABM	1.0 ug DNA	EUR 167.00

Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4858408	ABM	1.0 ug DNA	EUR 167.00

Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6347106	ABM	1.0 ug DNA	EUR 167.00

Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6347107	ABM	1.0 ug DNA	EUR 167.00

Eif3k sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6347108	ABM	1.0 ug DNA	EUR 167.00

For HAV and MNV, 2.6 and >3.four log₁₀ TCID₅₀/g had been measured. In abstract, the current research exhibits that osmotic dehydration seems an environment friendly management measure for the management of L. monocytogenes, S. enterica and E. coli O157:H7 if carried out at 40 °C or at 23 °C and adopted by air-drying at 100 °C. Primarily based on the outcomes generated with MNV, the mixed remedy can also be anticipated to scale back human Norovirus (NoV) however doesn’t seem like adequate to totally management HAV.

The outcomes contribute to a greater administration of the microbial security of osmotically dehydrated and dried berries and particularly the outcomes generated for the viruses emphasize that inside a strong meals security administration system, security have to be assured via the complete meals provide chain and due to this fact should begin at main manufacturing with the implementation of Good Agricultural Practices (GAP).