Effective Vaccine Management: The Case of a Rural District in Ghana.

Effective Vaccine Management: The Case of a Rural District in Ghana.

The Efficient Vaccine Administration (EVM) initiative supplies the platform wanted to observe and assess the vaccine provide chain system to determine strengths and weaknesses of the system in any respect ranges to reinforce the event of enchancment plan to strengthen the system. This valuation was carried out within the Tolon District of the Northern Area, Ghana.

A descriptive valuation of vaccine administration was carried out in six vaccine shops within the Tolon District of Northern Ghana. We employed World Well being Group (WHO) evaluation instruments and procedures which consisted of desk evaluations and interviews of chilly chain managers to evaluate vaccine administration practices within the district. 5 out of the 9 world evaluation standards had been assessed and a minimal goal stage required for all standards to satisfy the WHO normal was 80%.

Not one of the amenities assessed met the WHO benchmark of 80% for all however one standards assessed. On the subject of temperature management, the scores ranged from 42% at Kasuliyili CHPS Centre to 77% on the district retailer with a median district rating of 60%.

Inventory administration ranged between 11% at Wantugu Well being Centre and 75% at Nyankpala Well being Centre with district common rating of 32%. Efficient vaccine distribution scores ranged between 13% at Kasuliyili CHPS and 46% at Nyankpala Well being Centre with a median district rating of 27%.

Solely Nyankpala Well being Centre had an appropriate rating of 84% for vaccine administration, whereas the bottom rating for this indicator was 5% at Tolon Well being Centre retailer with district common rating of 53%. Info administration and supportive capabilities scores ranged from 0% at Tolon Well being Centre to 26% on the district retailer with the district common rating of 16%.

Nineteen (90.5%) of vaccine customers had poor data relating to temperature management and vaccine distribution.Efficient vaccine administration data and practices are poor at Tonlon district and requires pressing and pragmatic approaches reminiscent of coaching and re-training of vaccine customers in any respect ranges.

 Effective Vaccine Management: The Case of a Rural District in Ghana.
Efficient Vaccine Administration: The Case of a Rural District in Ghana.

Evaluation of things affecting vaccine chilly chain administration follow in public well being establishments in east Gojam zone of Amhara area.

Sustaining high quality of vaccines is likely one of the principal challenges of immunization packages in Ethiopia. The target of this examine is to evaluate the issue affecting vaccine chilly chain administration follow in immunization well being establishments in East Gojam zone of Amhara area, Ethiopia.An institutional primarily based cross-sectional examine was performed from March to April 2017 in ten districts of East Gojam zone of Amhara Area.

Descriptive statistics and Logistic regression evaluation had been carried out to determine components associated to the follow of chilly chain administration. Amongst 60 well being establishments, solely 46(76.7%) had useful fridges. Twenty-one (35%) had a useful generator for backup service and 28(46.6%) had a automobile/motorcycle for transportation of vaccines in case of fridge/energy failure.

EIF3I antibody

70R-17051 50 ul
EUR 435
Description: Rabbit polyclonal EIF3I antibody

EIF3I Antibody

43074-100ul 100ul
EUR 252

EIF3I Antibody

DF12393 200ul
EUR 304
Description: EIF3I antibody detects endogenous levels of EIF3I.

EIF3I Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3I. Recognizes EIF3I from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:2000-1:10000, IF:1:50-1:500

EIF3I Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF3I. Recognizes EIF3I from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT18358 2 ug
EUR 231

EIF3I Blocking Peptide

DF12393-BP 1mg
EUR 195

EIF3I Conjugated Antibody

C43074 100ul
EUR 397

EIF3I cloning plasmid

CSB-CL622652HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 978
  • Sequence: atgaagccgatcctactgcagggccatgagcggtccattacgcagattaagtataaccgcgaaggagacctcctctttactgtggccaaggaccctatcgtcaatgtatggtactctgtgaatggtgagaggctgggcacctacatgggccataccggagctgtgtggtgtgtgga
  • Show more
Description: A cloning plasmid for the EIF3I gene.

EIF3I Rabbit pAb

A6582-100ul 100 ul
EUR 308

EIF3I Rabbit pAb

A6582-200ul 200 ul
EUR 459

EIF3I Rabbit pAb

A6582-20ul 20 ul
EUR 183

EIF3I Rabbit pAb

A6582-50ul 50 ul
EUR 223

EIF3I Polyclonal Antibody

A51665 100 µg
EUR 570.55
Description: The best epigenetics products

anti- EIF3I antibody

FNab02710 100µg
EUR 505.25
  • Immunogen: eukaryotic translation initiation factor 3, subunit I
  • Uniprot ID: Q13347
  • Gene ID: 8668
  • Research Area: Metabolism
Description: Antibody raised against EIF3I

Anti-EIF3I antibody

PAab02710 100 ug
EUR 355

Anti-EIF3I antibody

STJ28665 100 µl
EUR 277

EIF3I Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3I. Recognizes EIF3I from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EIF3I Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3I. Recognizes EIF3I from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EIF3I Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3I. Recognizes EIF3I from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EIF3I protein (His tag)

80R-3526 100 ug
EUR 327
Description: Purified recombinant EIF3I protein (His tag)


ELI-31554h 96 Tests
EUR 824


ELI-26893b 96 Tests
EUR 928


EF009344 96 Tests
EUR 689

Rat EIF3I shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EIF3I shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EIF3I shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Eif3i ELISA KIT

ELI-47586m 96 Tests
EUR 865

EIF3I Recombinant Protein (Human)

RP010420 100 ug Ask for price

EIF3I Recombinant Protein (Rat)

RP199364 100 ug Ask for price

EIF3I Recombinant Protein (Mouse)

RP131291 100 ug Ask for price

EIF3I Polyclonal Antibody, HRP Conjugated

A51666 100 µg
EUR 570.55
Description: kits suitable for this type of research

EIF3I Polyclonal Antibody, FITC Conjugated

A51667 100 µg
EUR 570.55
Description: fast delivery possible

EIF3I Polyclonal Antibody, Biotin Conjugated

A51668 100 µg
EUR 570.55
Description: reagents widely cited

Eif3i ORF Vector (Rat) (pORF)

ORF066456 1.0 ug DNA
EUR 506

EIF3I ORF Vector (Human) (pORF)

ORF003474 1.0 ug DNA
EUR 95

Eif3i ORF Vector (Mouse) (pORF)

ORF043765 1.0 ug DNA
EUR 506

EIF3I sgRNA CRISPR Lentivector set (Human)

K0668201 3 x 1.0 ug
EUR 339

Eif3i sgRNA CRISPR Lentivector set (Mouse)

K4950301 3 x 1.0 ug
EUR 339

Eif3i sgRNA CRISPR Lentivector set (Rat)

K6258501 3 x 1.0 ug
EUR 339

EIF3I sgRNA CRISPR Lentivector (Human) (Target 1)

K0668202 1.0 ug DNA
EUR 154

EIF3I sgRNA CRISPR Lentivector (Human) (Target 2)

K0668203 1.0 ug DNA
EUR 154

EIF3I sgRNA CRISPR Lentivector (Human) (Target 3)

K0668204 1.0 ug DNA
EUR 154

Eif3i sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4950302 1.0 ug DNA
EUR 154

Eif3i sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4950303 1.0 ug DNA
EUR 154

Eif3i sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4950304 1.0 ug DNA
EUR 154

Eif3i sgRNA CRISPR Lentivector (Rat) (Target 1)

K6258502 1.0 ug DNA
EUR 154

Eif3i sgRNA CRISPR Lentivector (Rat) (Target 2)

K6258503 1.0 ug DNA
EUR 154

Eif3i sgRNA CRISPR Lentivector (Rat) (Target 3)

K6258504 1.0 ug DNA
EUR 154

EIF3I Protein Vector (Mouse) (pPB-C-His)

PV175058 500 ng
EUR 603

EIF3I Protein Vector (Mouse) (pPB-N-His)

PV175059 500 ng
EUR 603

EIF3I Protein Vector (Mouse) (pPM-C-HA)

PV175060 500 ng
EUR 603

EIF3I Protein Vector (Mouse) (pPM-C-His)

PV175061 500 ng
EUR 603

EIF3I Protein Vector (Rat) (pPB-C-His)

PV265822 500 ng
EUR 603

EIF3I Protein Vector (Rat) (pPB-N-His)

PV265823 500 ng
EUR 603

EIF3I Protein Vector (Rat) (pPM-C-HA)

PV265824 500 ng
EUR 603

EIF3I Protein Vector (Rat) (pPM-C-His)

PV265825 500 ng
EUR 603

EIF3I Protein Vector (Human) (pPB-C-His)

PV013893 500 ng
EUR 329

EIF3I Protein Vector (Human) (pPB-N-His)

PV013894 500 ng
EUR 329

EIF3I Protein Vector (Human) (pPM-C-HA)

PV013895 500 ng
EUR 329

EIF3I Protein Vector (Human) (pPM-C-His)

PV013896 500 ng
EUR 329

Recombinant Human EIF3I Protein, His, E.coli-1mg

QP11767-1mg 1mg
EUR 2757

Recombinant Human EIF3I Protein, His, E.coli-20ug

QP11767-20ug 20ug
EUR 201

Recombinant Human EIF3I Protein, His, E.coli-5ug

QP11767-5ug 5ug
EUR 155

Eif3i 3'UTR GFP Stable Cell Line

TU155721 1.0 ml Ask for price

Eif3i 3'UTR Luciferase Stable Cell Line

TU105721 1.0 ml Ask for price

Eif3i 3'UTR Luciferase Stable Cell Line

TU203888 1.0 ml Ask for price

Eif3i 3'UTR GFP Stable Cell Line

TU253888 1.0 ml Ask for price

EIF3I 3'UTR GFP Stable Cell Line

TU056744 1.0 ml
EUR 1394

EIF3I 3'UTR Luciferase Stable Cell Line

TU006744 1.0 ml
EUR 1394

EIF3I Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV665221 1.0 ug DNA
EUR 514

EIF3I Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV665225 1.0 ug DNA
EUR 514

EIF3I Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV665226 1.0 ug DNA
EUR 514

Rat Eukaryotic translation initiation factor 3 subunit I (Eif3i)

  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 40.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Eukaryotic translation initiation factor 3 subunit I(Eif3i) expressed in E.coli

Eukaryotic Translation Initiation Factor 3 Subunit I (EIF3I) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit I (EIF3I) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit I (EIF3I) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit I (EIF3I) Antibody

abx232710-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Rat Eukaryotic translation initiation factor 3 subunit I (Eif3i)

  • EUR 840.00
  • EUR 332.00
  • EUR 2170.00
  • EUR 1135.00
  • EUR 1579.00
  • EUR 470.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 38.9kDa
  • Buffer composition: Tris-based buffer, 50% glycerol
Description: Recombinant Rat Eukaryotic translation initiation factor 3 subunit I(Eif3i) expressed in Baculovirus

EIF3I Eukaryotic Translation Initiation Factor 3I Human Recombinant Protein

PROTQ13347 Regular: 20ug
EUR 317
Description: EIF3I Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 348 amino acids (1-325aa) and having a molecular mass of 38.9kDa.

Recombinant Aspergillus Clavatus EIF3I Protein (aa 1-340) [His]

VAng-Wyb3768-1mg 1 mg
EUR 4565
Description: Aspergillus Clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1) Eukaryotic Translation Initiation Factor 3, Subunit I, recombinant protein.

Recombinant Aspergillus Niger EIF3I Protein (aa 1-337) [His]

VAng-Wyb3888-1mg 1 mg
EUR 4551
Description: Aspergillus Niger (strain CBS 513.88 / FGSC A1513) Eukaryotic Translation Initiation Factor 3, Subunit I, recombinant protein.

Recombinant Aspergillus Oryzae EIF3I Protein (aa 1-335) [His]

VAng-Wyb3971-1mg 1 mg
EUR 4540
Description: Aspergillus Oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) Eukaryotic Translation Initiation Factor 3, Subunit I, recombinant protein.

Recombinant Aspergillus Terreus EIF3I Protein (aa 1-336) [His]

VAng-Wyb4049-1mg 1 mg
EUR 4545
Description: Aspergillus Terreus (strain NIH 2624 / FGSC A1156) Eukaryotic Translation Initiation Factor 3, Subunit I, recombinant protein.

Eukaryotic Translation Initiation Factor 3 Subunit I (EIF3I) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit I (EIF3I) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit I (EIF3I) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit I (EIF3I) Antibody Pair

abx117481-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

EIF3I sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0668205 3 x 1.0 ug
EUR 376

Eif3i sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4950305 3 x 1.0 ug
EUR 376

Eif3i sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6258505 3 x 1.0 ug
EUR 376

Human Eukaryotic Translation Initiation Factor 3 Subunit I (EIF3I) ELISA Kit

abx387098-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

EIF3I sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0668206 1.0 ug DNA
EUR 167

EIF3I sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0668207 1.0 ug DNA
EUR 167

EIF3I sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0668208 1.0 ug DNA
EUR 167

Eif3i sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4950306 1.0 ug DNA
EUR 167

Eif3i sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4950307 1.0 ug DNA
EUR 167

Eif3i sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4950308 1.0 ug DNA
EUR 167

EIF3I Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV665222 1.0 ug DNA
EUR 514

EIF3I Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV665223 1.0 ug DNA
EUR 572

EIF3I Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV665224 1.0 ug DNA
EUR 572

Eif3i sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6258506 1.0 ug DNA
EUR 167

Eif3i sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6258507 1.0 ug DNA
EUR 167

Eif3i sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6258508 1.0 ug DNA
EUR 167

Recombinant Saccharomyces Cerevisiae EIF3I Protein (aa 1-347) [His] (strain YJM789)

VAng-Wyb4590-1mg 1 mg
EUR 4587
Description: Saccharomyces Cerevisiae (strain YJM789) (Bakers yeast) Eukaryotic Translation Initiation Factor 3, Subunit I, recombinant protein.

Recombinant Saccharomyces Cerevisiae EIF3I Protein (aa 1-347) [His] (strain ATCC 204508 / S288c)

VAng-Wyb4589-1mg 1 mg
EUR 4587
Description: Saccharomyces Cerevisiae (strain ATCC 204508 / S288c) (Bakers yeast) Eukaryotic Translation Initiation Factor 3, Subunit I, recombinant protein.

Twenty-nine (48.3%) had identified the proper vaccine storage temperature (2 °C – 8 °C) within the fridge and the outcomes of this examine revealed that solely 23(38.3%) of respondents had adequate data about vaccine chilly chain administration.

The discovering of this examine additionally revealed that 35(58.3%) had applicable vaccine chilly chain administration follow and the remainder 25(41.7%) had inappropriate follow. Logistic regression confirmed us the data hole and career had been considerably related to vaccine chilly chain administration follow at P < 0.05.This examine signifies that there was a data hole of well being staff who’re engaged on chilly chain administration. There may be an pressing want to enhance data and follow on chilly chain administration by improved supervision and coaching at a special stage of well being care system.

Leave a Comment

Your email address will not be published. Required fields are marked *

Scroll to Top