Co-Occurrence of Free-Living Amoeba and Legionella in Drinking Water Supply Systems.

Co-Occurrence of Free-Living Amoeba and Legionella in Drinking Water Supply Systems.

Background and Goals:Legionella is without doubt one of the most essential water-related pathogens. Contained in the water provide methods and the biofilms, Legionella works together with different micro organism and free-living amoeba (FLA). A number of amoebas might function hosts for micro organism in aquatic methods.

This research aimed to analyze the co-occurrence of Legionella spp. and FLA in consuming water provide methods. Supplies and Strategies: A complete of 268 water samples have been collected from condominium buildings, lodges, and public buildings.

Detection of Legionella spp. was carried out in accordance with ISO 11731:2017 normal. Three totally different polymerase chain response (PCR) protocols have been used to establish FLA. Outcomes: Incidence of Legionella various from a mean of 12.5% in chilly water samples with essentially the most frequent prevalence noticed in scorching water, in areas receiving untreated groundwater, the place 54.0% of the samples have been Legionella constructive.

The prevalence of FLA was considerably larger. On common, 77.2% of samples contained no less than one genus of FLA and, relying on the kind of pattern, the prevalence of FLA might attain 95%. Within the samples collected in the course of the research, Legionella was all the time remoted together with FLA, no samples containing Legionella within the absence of FLA have been noticed.

Conclusions: The info obtained in our research will help to give attention to the intensive distribution, shut interplay, and long-term persistence of Legionella and FLA. Lack of Legionella threat administration plans and management procedures might promote additional unfold of Legionella in water provide methods. As well as, the excessive incidence of Legionella-related FLA means that conventional monitoring strategies will not be ample for Legionella management.

Co-Occurrence of Free-Living Amoeba and Legionella in Drinking Water Supply Systems.
Co-Incidence of Free-Residing Amoeba and Legionella in Ingesting Water Provide Methods.

Temperature sensitivity and environmental stability of Chandipura virus.

Chandipura virus (CHPV), a negative-stranded RNA virus of household Rhabdoviridae is endemic in Central India since 1965. The virus gained public well being significance when it was held answerable for huge outbreak in 2003-2004 in Maharashtra, Telengana and Gujarat with case fatality charges starting from 55 to 75% amongst youngsters.

We studied the soundness of the virus in addition to RNA persistence in samples saved at totally different temperatures for various intervals. CHPV remained infective in sand flies and cell tradition supernatants at 4 °C for eight weeks. At 37 °C CHPV remained viable for 18 days when saved in contaminated cell supernatant (Minimal important medium supplemented with 10% fetal bovine serum).

EIF3H antibody

70R-17050 50 ul
EUR 435
Description: Rabbit polyclonal EIF3H antibody

EIF3H Antibody

36437-100ul 100ul
EUR 252

EIF3H Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EIF3H. Recognizes EIF3H from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

EIF3H Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EIF3H. Recognizes EIF3H from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:100-1:300

EIF3H antibody

70R-8910 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal EIF3H antibody

EIF3H antibody

70R-8911 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal EIF3H antibody

EIF3H Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF3H. Recognizes EIF3H from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

EIF3H Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF3H. Recognizes EIF3H from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

EIF3H Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EIF3H. Recognizes EIF3H from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF3H Rabbit pAb

A13378-100ul 100 ul
EUR 308

EIF3H Rabbit pAb

A13378-200ul 200 ul
EUR 459

EIF3H Rabbit pAb

A13378-20ul 20 ul
EUR 183

EIF3H Rabbit pAb

A13378-50ul 50 ul
EUR 223

EIF3H Blocking Peptide

33R-5201 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF3H antibody, catalog no. 70R-8911

EIF3H Blocking Peptide

33R-5760 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF3H antibody, catalog no. 70R-8910

EIF3H Conjugated Antibody

C36437 100ul
EUR 397

EIF3H cloning plasmid

CSB-CL007537HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1059
  • Sequence: atggcgtcccgcaaggaaggtaccggctctactgccacctcttccagctccaccgccggcgcagcagggaaaggcaaaggcaaaggcggctcgggagattcagccgtgaagcaagtgcagatagatggccttgtggtattaaagataatcaaacattatcaagaagaaggacaag
  • Show more
Description: A cloning plasmid for the EIF3H gene.

EIF3H Rabbit pAb

A7024-100ul 100 ul
EUR 308

EIF3H Rabbit pAb

A7024-200ul 200 ul
EUR 459

EIF3H Rabbit pAb

A7024-20ul 20 ul
EUR 183

EIF3H Rabbit pAb

A7024-50ul 50 ul
EUR 223

anti- EIF3H antibody

FNab02709 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • IP: 1:50 - 1:200
  • Immunogen: eukaryotic translation initiation factor 3, subunit H
  • Uniprot ID: O15372
  • Gene ID: 8667
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against EIF3H

Anti-EIF3H antibody

PAab02709 100 ug
EUR 386

Anti-EIF3H antibody

STJ115340 100 µl
EUR 277

Anti-EIF3H antibody

STJ119999 100 µl
EUR 413

Anti-EIF3H antibody

STJ29104 100 µl
EUR 277


ELI-09165h 96 Tests
EUR 824


ELI-26103b 96 Tests
EUR 928


EF009343 96 Tests
EUR 689

Rat EIF3H shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EIF3H shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EIF3H shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Eif3h ELISA KIT

ELI-32670m 96 Tests
EUR 865


ELI-48145c 96 Tests
EUR 928

pCMV-SPORT6.1-EIF3H Plasmid

PVT16940 2 ug
EUR 325

EIF3H Recombinant Protein (Human)

RP010417 100 ug Ask for price

EIF3H Recombinant Protein (Rat)

RP199361 100 ug Ask for price

EIF3H Recombinant Protein (Mouse)

RP131288 100 ug Ask for price

[KO Validated] EIF3H Rabbit pAb

A18026-100ul 100 ul
EUR 410

[KO Validated] EIF3H Rabbit pAb

A18026-200ul 200 ul
EUR 571

[KO Validated] EIF3H Rabbit pAb

A18026-20ul 20 ul
EUR 221

[KO Validated] EIF3H Rabbit pAb

A18026-50ul 50 ul
EUR 287

Eif3h ORF Vector (Rat) (pORF)

ORF066455 1.0 ug DNA
EUR 506

EIF3H ORF Vector (Human) (pORF)

ORF003473 1.0 ug DNA
EUR 95

Eif3h ORF Vector (Mouse) (pORF)

ORF043764 1.0 ug DNA
EUR 506

pENTR223-EIF3H-G6A-A1047 vector

PVT11906 2 ug
EUR 308

EIF3H sgRNA CRISPR Lentivector set (Human)

K0668101 3 x 1.0 ug
EUR 339

Eif3h sgRNA CRISPR Lentivector set (Rat)

K7383001 3 x 1.0 ug
EUR 339

Eif3h sgRNA CRISPR Lentivector set (Mouse)

K4676501 3 x 1.0 ug
EUR 339

EIF3H sgRNA CRISPR Lentivector (Human) (Target 1)

K0668102 1.0 ug DNA
EUR 154

EIF3H sgRNA CRISPR Lentivector (Human) (Target 2)

K0668103 1.0 ug DNA
EUR 154

EIF3H sgRNA CRISPR Lentivector (Human) (Target 3)

K0668104 1.0 ug DNA
EUR 154

Eif3h sgRNA CRISPR Lentivector (Rat) (Target 1)

K7383002 1.0 ug DNA
EUR 154

Eif3h sgRNA CRISPR Lentivector (Rat) (Target 2)

K7383003 1.0 ug DNA
EUR 154

Eif3h sgRNA CRISPR Lentivector (Rat) (Target 3)

K7383004 1.0 ug DNA
EUR 154

Eif3h sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4676502 1.0 ug DNA
EUR 154

Eif3h sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4676503 1.0 ug DNA
EUR 154

Eif3h sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4676504 1.0 ug DNA
EUR 154

EIF3H Protein Vector (Mouse) (pPB-C-His)

PV175054 500 ng
EUR 603

EIF3H Protein Vector (Mouse) (pPB-N-His)

PV175055 500 ng
EUR 603

EIF3H Protein Vector (Mouse) (pPM-C-HA)

PV175056 500 ng
EUR 603

EIF3H Protein Vector (Mouse) (pPM-C-His)

PV175057 500 ng
EUR 603

EIF3H Protein Vector (Rat) (pPB-C-His)

PV265818 500 ng
EUR 603

EIF3H Protein Vector (Rat) (pPB-N-His)

PV265819 500 ng
EUR 603

EIF3H Protein Vector (Rat) (pPM-C-HA)

PV265820 500 ng
EUR 603

EIF3H Protein Vector (Rat) (pPM-C-His)

PV265821 500 ng
EUR 603

EIF3H Protein Vector (Human) (pPB-C-His)

PV013889 500 ng
EUR 329

EIF3H Protein Vector (Human) (pPB-N-His)

PV013890 500 ng
EUR 329

EIF3H Protein Vector (Human) (pPM-C-HA)

PV013891 500 ng
EUR 329

EIF3H Protein Vector (Human) (pPM-C-His)

PV013892 500 ng
EUR 329

Eif3h 3'UTR GFP Stable Cell Line

TU155720 1.0 ml Ask for price

Eif3h 3'UTR Luciferase Stable Cell Line

TU105720 1.0 ml Ask for price

Eif3h 3'UTR Luciferase Stable Cell Line

TU203887 1.0 ml Ask for price

Eif3h 3'UTR GFP Stable Cell Line

TU253887 1.0 ml Ask for price

EIF3H 3'UTR GFP Stable Cell Line

TU056743 1.0 ml
EUR 1521

EIF3H 3'UTR Luciferase Stable Cell Line

TU006743 1.0 ml
EUR 1521

EIF3H Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV663199 1.0 ug DNA
EUR 682

EIF3H Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV663203 1.0 ug DNA
EUR 682

EIF3H Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV663204 1.0 ug DNA
EUR 682

Eukaryotic Translation Initiation Factor 3 Subunit H (EIF3H) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit H (EIF3H) Antibody

abx027084-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit H (EIF3H) Antibody

abx027084-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit H (EIF3H) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit H (eIF3H) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit H (EIF3H) Antibody

abx032908-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit H (EIF3H) Antibody

abx032908-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit H (EIF3H) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit H (EIF3H) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit H (EIF3H) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit H (EIF3H) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit H (EIF3H) Antibody

abx232709-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Aspergillus Clavatus EIF3H Protein (aa 1-365) [His]

VAng-Wyb3767-1mg 1 mg
EUR 4659
Description: Aspergillus Clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1) Eukaryotic Translation Initiation Factor 3 Subunit H, recombinant protein.

EIF3H sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0668105 3 x 1.0 ug
EUR 376

Eif3h sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7383005 3 x 1.0 ug
EUR 376

Eif3h sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4676505 3 x 1.0 ug
EUR 376

Human Eukaryotic Translation Initiation Factor 3 Subunit H (EIF3H) ELISA Kit

abx387097-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

EIF3H sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0668106 1.0 ug DNA
EUR 167

EIF3H sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0668107 1.0 ug DNA
EUR 167

EIF3H sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0668108 1.0 ug DNA
EUR 167

Eif3h sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7383006 1.0 ug DNA
EUR 167

Eif3h sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7383007 1.0 ug DNA
EUR 167

Eif3h sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7383008 1.0 ug DNA
EUR 167

EIF3H Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV663200 1.0 ug DNA
EUR 682

EIF3H Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV663201 1.0 ug DNA
EUR 740

EIF3H Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV663202 1.0 ug DNA
EUR 740

Eif3h sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4676506 1.0 ug DNA
EUR 167

Eif3h sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4676507 1.0 ug DNA
EUR 167

Eif3h sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4676508 1.0 ug DNA
EUR 167

Nonetheless, in contaminated sand flies saved at 37 °C, the virus misplaced virulence inside per week. CHPV RNA, although misplaced virulence, might be detected in virus uncovered sand flies saved at 37 °C for 13 weeks by actual time RT-PCR. Retaining virulence at 37 °C for 18 days in serum containing medium is a matter of concern for laboratories and hospital settings the place medical samples are dealt with.

RNA persistence for extended intervals in lifeless sand flies may assist in surveillance research of CHPV in sand flies and can assist in useful resource constraint nations the place chilly chain administration is a priority.

Leave a Comment

Your email address will not be published. Required fields are marked *

Scroll to Top